Awareness of and Attitudes Toward User Involvement in Research on Aging and Health

Impact of standard supply of care on receiving smoking cessation recommendation: Korean Nationwide Well being Panel information evaluation

Background: Regardless of varied anti-smoking insurance policies, the smoking fee in adults remains to be excessive in Korea. Docs’ recommendation is understood to extend the smoking cessation success fee. Nevertheless, few research have reported the impact of getting a standard supply of care (USC) on receiving smoking cessation recommendation.

 

Goal: To find out the impact of USC on receiving smoking cessation recommendation.

 

Strategies: We carried out a number of panel logistic regression analyses to determine the impact of getting a USC on the speed of receiving a physician’s smoking cessation recommendation utilizing 2009, 2012 and 2013 datasets from the Korea Well being Panel database. Solely individuals who responded to questions concerning a USC and smoking cessation recommendation have been analysed. Finally, 5243 observations have been included within the last evaluation.

 

Outcomes: A better share of individuals with a USC obtained smoking cessation recommendation from docs (58.4% in 2009, 64.0% in 2012 and 59.6% in 2013) than these not having a USC (28.6% in 2009, 37.5% in 2012 and 34.8% in 2013). The percentages ratios (ORs) of receiving smoking cessation recommendation in individuals with a USC have been increased than these of individuals with no USC after performing a number of panel logistic regression evaluation with random results (OR: 2.24; 95% confidence interval: 1.90-2.63).

 

Conclusions: Having a USC elevated the percentages of receiving a physician’s smoking cessation recommendation in Koreans. The outcomes of this research recommend {that a} well being care coverage that encourages having a USC is helpful in receiving extra smoking cessation recommendation in a Korean inhabitants.

muzeumamonitow
muzeumamonitow

Core Panel Multi-Tumor control slides

TS900 Set of 5
EUR 218

Core Panel Multi-Tumor control slides

TS900-25 Set of 25
EUR 485

Breast Panel Multi-Tumor control slides

TS901 Set of 5
EUR 218

Breast Panel Multi-Tumor control slides

TS901-25 Set of 25
EUR 485

HAV

DAG178 1 ml
EUR 629

Ivd/ Rat Ivd ELISA Kit

ELI-39421r 96 Tests
EUR 886

HAV HAV P2C recombinant antigen

00165-V-01mg 0,1 mg
EUR 267.5
  • Category: Antigens, HAV, Ag
Description: HAV HAV P2C recombinant antigen a.a. 1121-1234.

HAV HAV P2C recombinant antigen

00165-V-1000ug 1000 ug
EUR 1282.5
  • Category: Antigens, HAV, Ag
Description: HAV HAV P2C recombinant antigen a.a. 1121-1234.

IVD antibody

22140-100ul 100ul
EUR 390

IVD antibody

70R-18039 50 ul
EUR 435
Description: Rabbit polyclonal IVD antibody

IVD antibody

70R-13603 100 ul
EUR 457
Description: Affinity purified Rabbit polyclonal IVD antibody

IVD antibody

10R-4491 100 ul
EUR 691
Description: Mouse monoclonal IVD antibody

IVD Antibody

DF12284 200ul
EUR 304
Description: IVD antibody detects endogenous levels of IVD.

IVD Antibody

1-CSB-PA011921GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against IVD. Recognizes IVD from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC

IVD Antibody

1-CSB-PA011921LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against IVD. Recognizes IVD from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:500-1:1000

IVD siRNA

20-abx902738
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

IVD siRNA

20-abx920988
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

IVD siRNA

20-abx920989
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-IVD

YF-PA12811 50 ug
EUR 363
Description: Mouse polyclonal to IVD

anti-IVD

YF-PA12812 100 ug
EUR 403
Description: Rabbit polyclonal to IVD

HAV VP1

DAG1443 100 µg
EUR 645

HAV VP3

DAG1450 100 µg
EUR 645

HAV Protein

abx069838-1ml 1 ml
EUR 314
  • Shipped within 5-10 working days.

HAV Protein

abx069839-1ml 1 ml
EUR 982
  • Shipped within 5-10 working days.

HAV Antigen

E61H00101 1mg
EUR 611

Bordetella bronchiseptica proteins (inactivated vaccine for dog) for ELISA

BBV15-N-100 100 ug
EUR 286

IVD Polyclonal Antibody

28898-100ul 100ul
EUR 252

IVD Polyclonal Antibody

28898-50ul 50ul
EUR 187

IVD Rabbit pAb

A15281-100ul 100 ul
EUR 308

IVD Rabbit pAb

A15281-200ul 200 ul
EUR 459

IVD Rabbit pAb

A15281-20ul 20 ul
EUR 183

IVD Rabbit pAb

A15281-50ul 50 ul
EUR 223

Human IVD Antibody

33170-05111 150 ug
EUR 261

IVD Blocking Peptide

DF12284-BP 1mg
EUR 195

IVD cloning plasmid

CSB-CL011921HU-10ug 10ug
EUR 465
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1272
  • Sequence: atggcgactgcgactcggctgctggggtgtcgtgtggcgagctggaggctgcggccgccgcttgccggcttcgtttcccagcgggcccactcgcttttgcccgtggacgatgcaatcaatgggctaagcgaggagcagaggcagcttcgtcagaccatggctaagttccttcagg
  • Show more
Description: A cloning plasmid for the IVD gene.

anti- IVD antibody

FNab04426 100µg
EUR 505.25
  • Immunogen: isovaleryl Coenzyme A dehydrogenase
  • Uniprot ID: P26440
  • Gene ID: 3712
  • Research Area: Metabolism
Description: Antibody raised against IVD

anti- IVD antibody

FNab04427 100µg
EUR 585
  • Recommended dilution: WB: 1:1000-1:6000
  • IHC: 1:20-1:200
  • IF: 1:10-1:100
  • Immunogen: isovaleryl Coenzyme A dehydrogenase
  • Uniprot ID: P26440
  • Gene ID: 3712
  • Research Area: Metabolism
Description: Antibody raised against IVD

Anti-IVD antibody

PAab04426 100 ug
EUR 355

IVD, Human Recombinant

P1577-100 100 µg
EUR 510

IVD, Human Recombinant

P1577-20 20 µg
EUR 156

Anti-IVD antibody

STJ117476 100 µl
EUR 277
Description: Isovaleryl-CoA dehydrogenase (IVD) is a mitochondrial matrix enzyme that catalyzes the third step in leucine catabolism. The genetic deficiency of IVD results in an accumulation of isovaleric acid, which is toxic to the central nervous system and leads to isovaleric acidemia. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.

Saponin Vaccine Adjuvant

VAdv-Ly0009 1 g
EUR 1095
Description: Saponin Vaccine Adjuvant, plant-based vaccine adjuvant.

HAV VP3 antibody

10R-10488 100 ug
EUR 435
Description: Mouse monoclonal HAV VP3 antibody

HAV VP3 antibody

10R-10489 100 ug
EUR 435
Description: Mouse monoclonal HAV VP3 antibody

HAV VP1 antibody

10R-10520 100 ug
EUR 435
Description: Mouse monoclonal HAV VP1 antibody

HAV VP1 antibody

10R-10521 100 ug
EUR 435
Description: Mouse monoclonal HAV VP1 antibody

HAV VP1 antibody

10R-10522 100 ug
EUR 435
Description: Mouse monoclonal HAV VP1 antibody

HAV P2C-P3A

DAG1448 100 µg
EUR 645

HAV VP2-VP4

DAG1451 100 µg
EUR 645

HAV VP3 Antibody

abx018272-100ug 100 ug
EUR 384
  • Shipped within 5-10 working days.

HAV VP3 Antibody

abx018273-100ug 100 ug
EUR 384
  • Shipped within 5-10 working days.

HAV VP1 Antibody

abx018304-100ug 100 ug
EUR 384
  • Shipped within 5-10 working days.

HAV VP1 Antibody

abx018305-100ug 100 ug
EUR 384
  • Shipped within 5-10 working days.

HAV VP1 Antibody

abx018306-100ug 100 ug
EUR 384
  • Shipped within 5-10 working days.

HAV P3C Protein

abx060523-1mg 1 mg
EUR 1511
  • Shipped within 5-10 working days.

HAV VP1 Protein

abx060524-1mg 1 mg
EUR 1525
  • Shipped within 5-10 working days.

HAV VP3 Protein

abx060526-1mg 1 mg
EUR 1525
  • Shipped within 5-10 working days.

HAV monoclonal antibody

VAnt-Lsx001-1mg 1 mg
EUR 2577
Description: HAV, Monoclonal Antibody; contains a high concentration of viral antibody.

HAV monoclonal antibody

VAnt-Lsx001-5mg 5mg
EUR 4970
Description: HAV, Monoclonal Antibody; contains a high concentration of viral antibody.

HAV antibody (HRP)

VAnt-Lsx014-1mg 1 mg
EUR 3268
Description: HRP is conjugated to HAV antibody to detect the target molecule.

HAV antibody (HRP)

VAnt-Lsx014-5mg 5mg
EUR 6163
Description: HRP is conjugated to HAV antibody to detect the target molecule.

Recombinant flagellin FlicC vaccine adjuvant (TLR5 agonist); vaccine adjuvant

AV-7010-50 50 ug
EUR 895

ELISA kit for Human PLA2G4D (Phospholipase A2, Group IVD)

ELK6188 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Phospholipase A2, Group IVD (PLA2G4D). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific
  • Show more
Description: A sandwich ELISA kit for detection of Phospholipase A2, Group IVD from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Goat IgG (-ve control for flow cytometry) (isotype control)

20011-100 100 test
EUR 103

IVD protein (His tag)

80R-1262 100 ug
EUR 268
Description: Purified recombinant Human IVD protein

Human IVD ELISA KIT

ELI-12848h 96 Tests
EUR 824

Bovine IVD ELISA KIT

ELI-13527b 96 Tests
EUR 928

IVD ELISA KIT|Human

EF010406 96 Tests
EUR 689

Mouse Ivd ELISA KIT

ELI-43520m 96 Tests
EUR 865

Mouse IVD shRNA Plasmid

20-abx974716
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat IVD shRNA Plasmid

20-abx984521
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

IVD Polyclonal Conjugated Antibody

C28898 100ul
EUR 397

IVD Antibody, HRP conjugated

1-CSB-PA011921LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against IVD. Recognizes IVD from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

IVD Antibody, FITC conjugated

1-CSB-PA011921LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against IVD. Recognizes IVD from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

IVD Antibody, Biotin conjugated

1-CSB-PA011921LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against IVD. Recognizes IVD from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Human IVD shRNA Plasmid

20-abx952499
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

IVD Recombinant Protein (Human)

RP016447 100 ug Ask for price

IVD Recombinant Protein (Rat)

RP206471 100 ug Ask for price

IVD Recombinant Protein (Mouse)

RP144596 100 ug Ask for price

BSA Control for Age-BSA

2221-BSA
EUR 175

BSA Control for AGE-BSA

35R-AA007 10 mg
EUR 224
Description: BSA Control for AGE protein (BSA modified), Cat No. 30R-AA007

Hepatitis A Virus (HAV) antigens (FRhk4, inactivated) for ELISA

HAV15-N-100 100 ug
EUR 347

Calcium phosphate vaccine adjuvant

AV-1020-100 100 ml
EUR 219

Peanut Oil vaccine adjuvant

AV-5010-50 50 ml
EUR 225

Mineral Oil vaccine adjuvant

AV-5020-50 50 ml
EUR 225

Mannide monooleate vaccine adjuvant

AV-5030-5 5 g
EUR 164

HS15 Kolliphore vaccine adjuvant

AV-6010-100 100 g
EUR 286

Pam2CSK4 vaccine adjuvant, unlabeled

AV-9020-1 1 mg
EUR 408

Pam3CSK4 vaccine adjuvant, unlabeled

AV-9025-1 1 mg
EUR 286

Mouse Monoclonal Anti-Gardasil vaccine L1s (Human Papilloma Virus/HPV6+11+16+18 late proteins) antiserum control for ELISA

HPV618L13-S 1 ml
EUR 469

HAV P3C recombinant antigen

00162-V-01mg 0,1 mg
EUR 267.5
  • Category: Antigens, HAV, Ag
Description: HAV P3C recombinant antigen a.a. 1643-1743.

HAV P3C recombinant antigen

00162-V-1000ug 1000 ug
EUR 1282.5
  • Category: Antigens, HAV, Ag
Description: HAV P3C recombinant antigen a.a. 1643-1743.

HAV VP3 recombinant antigen

00163-V-01mg 0,1 mg
EUR 267.5
  • Category: Antigens, HAV, Ag
Description: HAV VP3 recombinant antigen a.a. 304-415.

HAV VP3 recombinant antigen

00163-V-1000ug 1000 ug
EUR 1282.5
  • Category: Antigens, HAV, Ag
Description: HAV VP3 recombinant antigen a.a. 304-415.

HAV IgM ELISA Kit

DEIA1012 96T
EUR 533
Description: HAV-IgM ELISA is an enzyme-linked immunosorbent assay for qualitative determination of hepatitis A virus IgM-class antibodies in human serum or plasma samples. The assay is intended to be used in clinical laboratories for diagnosis and management of patients related to infection with hepatitis A virus.

HAV P2C-P3A Protein

abx060522-1mg 1 mg
EUR 1511
  • Shipped within 5-10 working days.

HAV VP1-P2A Protein

abx060525-1mg 1 mg
EUR 1525
  • Shipped within 5-10 working days.

Inactivated HAV Antigen (Monkey)

VAng-Lsx0156-inquire inquire Ask for price
Description: HAV, native protein from monkey. Inactivated native Hepatitis A Virus Antigen preparation is inactivated by incubating with formaldehyde for 96 hours.

Inactivated HAV Antigen (Human)

VAng-Lsx0157-1mL 1 mL
EUR 226
Description: HAV-Antigen is prepared of the supernatant of infected Wannenstapel and dialysed against phosphat buffered saline.

 

Consciousness of and Attitudes Towards Person Involvement in Analysis on Getting older and Well being: Protocol for a Quantitative Massive-Scale Panel Examine

Background: Person involvement is a requirement of most analysis funders. There’s a rising physique of literature exploring the advantages and challenges of person involvement in analysis, however such research are scarce within the discipline of getting older and well being.

 

Furthermore, the vast majority of such analysis is qualitative, which limits the generalizability of outcomes. The UserAge panel research can be instrumental in increasing data that can profit the standard and influence of person involvement in future analysis.

 

Goal: The goal of this research is to find out the notice and understanding of and attitudes towards person involvement in analysis amongst totally different classes of data customers and researchers over time.

 

Strategies: A panel research can be carried out with three totally different classes of data customers (individuals aged 60 years and older, casual carers, and professionals in well being care and structure) and researchers in getting older and well being.

  • An expert survey firm will gather information from all samples in parallel. Potential contributors can be requested to finish the survey by way of phone or on-line, or contributors can request a paper survey to be despatched to them within the put up. A draft set of questions on attitudes and behavioral patterns associated to analysis utilization and person involvement in analysis was compiled based mostly on current literature and enter from the analysis crew.
  • Utilizing a participatory method, we engaged a person discussion board, the place Eight older individuals and three researchers collectively refined the survey for time/size to finish, terminology, readability, and context. Knowledge collected by way of the web or phone can be mechanically processed, and information collected on paper kinds can be entered in machine-readable kinds.
  • The survey firm will retailer all information and ship the quality-controlled database to the college for additional storage. Analyses of frequencies and measures of central tendency can be used for descriptive functions. To match teams, state-of-the artwork statistical analyses can be used.

 

Outcomes: Knowledge assortment for the primary research wave began in September 2019 and can be accomplished in spring 2020. Knowledge can be prepared for evaluation following cleansing and high quality management, which began throughout summer season 2020 and can be accomplished autumn 2020. We anticipate the info assortment for the second research wave to start out in September 2021.

 

Conclusions: That is the primary quantitative large-scale panel research specializing in tendencies in attitudes towards, consciousness of, and data about person involvement in analysis on getting older and well being in Sweden. The outcomes will generate new and essential data to advance the understanding of person wants and preferences in addition to the relevance of person involvement in analysis on getting older and well being.

 

HBV LONGITUDINAL PANEL (12 X 1 mL)

6548 12 X 1 mL
EUR 1261.6
  • What is the product classification?
  • HBV LONGITUDINAL PANEL is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV LONGITUDINAL PANEL (12 X 1 mL)

6501 12 X 1 mL
EUR 1261.6
  • What is the product classification?
  • HBV LONGITUDINAL PANEL is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV LONGITUDINAL PANEL (15 X 1 mL)

6512 15 X 1 mL
EUR 1261.6
  • What is the product classification?
  • HBV LONGITUDINAL PANEL is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV LONGITUDINAL PANEL (12 X 1 mL)

6516 12 X 1 mL
EUR 1261.6
  • What is the product classification?
  • HBV LONGITUDINAL PANEL is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV LONGITUDINAL PANEL (12 X 1 mL)

6518 12 X 1 mL
EUR 1261.6
  • What is the product classification?
  • HBV LONGITUDINAL PANEL is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV LONGITUDINAL PANEL (12 X 1 mL)

6528 12 X 1 mL
EUR 1261.6
  • What is the product classification?
  • HBV LONGITUDINAL PANEL is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV LONGITUDINAL PANEL (12 X 1 mL)

6529 12 X 1 mL
EUR 1261.6
  • What is the product classification?
  • HBV LONGITUDINAL PANEL is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV LONGITUDINAL PANEL (12 X 1 mL)

6538 12 X 1 mL
EUR 1261.6
  • What is the product classification?
  • HBV LONGITUDINAL PANEL is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

Positive control tissue section for each antibody; Based on availability INQUIRE

Control-Slides Set of 5
EUR 176

Core Panel Multi-Tumor control slides

TS900 Set of 5
EUR 218

Core Panel Multi-Tumor control slides

TS900-25 Set of 25
EUR 485

Breast Panel Multi-Tumor control slides

TS901 Set of 5
EUR 218

Breast Panel Multi-Tumor control slides

TS901-25 Set of 25
EUR 485

HBV Seroconversion Panel Donor# 64090 (5 X 1 mL)

HBV10231 5 X 1 mL
EUR 582.48
  • What is the product classification?
  • HBV Seroconversion Panel Donor# 64090 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 64017 (6 X 1 mL)

HBV10232 6 X 1 mL
EUR 582.48
  • What is the product classification?
  • HBV Seroconversion Panel Donor# 64017 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 65449 (9 X 1 mL)

HBV11000 9 X 1 mL
EUR 859.12
  • What is the product classification?
  • HBV Seroconversion Panel Donor# 65449 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 65524 (8 X 1 mL)

HBV11001 8 X 1 mL
EUR 859.12
  • What is the product classification?
  • HBV Seroconversion Panel Donor# 65524 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 65556 (6 X 1 mL)

HBV11002 6 X 1 mL
EUR 859.12
  • What is the product classification?
  • HBV Seroconversion Panel Donor# 65556 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 65584 (8 X 1 mL)

HBV11003 8 X 1 mL
EUR 859.12
  • What is the product classification?
  • HBV Seroconversion Panel Donor# 65584 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 65732 (8 X 1 mL)

HBV11004 8 X 1 mL
EUR 859.12
  • What is the product classification?
  • HBV Seroconversion Panel Donor# 65732 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 65777 (14 X 1 mL)

HBV11005 14 X 1 mL
EUR 859.12
  • What is the product classification?
  • HBV Seroconversion Panel Donor# 65777 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 66201 (17 X 1 mL)

HBV11006 17 X 1 mL
EUR 859.12
  • What is the product classification?
  • HBV Seroconversion Panel Donor# 66201 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 66537 (14 X 1 mL)

HBV11007 14 X 1 mL
EUR 859.12
  • What is the product classification?
  • HBV Seroconversion Panel Donor# 66537 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 67303 (18 X 1 mL)

HBV11008 18 X 1 mL
EUR 859.12
  • What is the product classification?
  • HBV Seroconversion Panel Donor# 67303 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 67449 (23 X 1 mL)

HBV11009 23 X 1 mL
EUR 859.12
  • What is the product classification?
  • HBV Seroconversion Panel Donor# 67449 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 67457 (18 X 1 mL)

HBV11010 18 X 1 mL
EUR 859.12
  • What is the product classification?
  • HBV Seroconversion Panel Donor# 67457 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 67694 (14 X 1 mL)

HBV11011 14 X 1 mL
EUR 859.12
  • What is the product classification?
  • HBV Seroconversion Panel Donor# 67694 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 67773 (6 X 1 mL)

HBV11012 6 X 1 mL
EUR 859.12
  • What is the product classification?
  • HBV Seroconversion Panel Donor# 67773 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 67962 (35 X 1 mL)

HBV11013 35 X 1 mL
EUR 859.12
  • What is the product classification?
  • HBV Seroconversion Panel Donor# 67962 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 68029 (12 X 1 mL)

HBV11014 12 X 1 mL
EUR 859.12
  • What is the product classification?
  • HBV Seroconversion Panel Donor# 68029 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 68105 (14 X 1 mL)

HBV11015 14 X 1 mL
EUR 859.12
  • What is the product classification?
  • HBV Seroconversion Panel Donor# 68105 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 68541 (10 X 1 mL)

HBV11016 10 X 1 mL
EUR 859.12
  • What is the product classification?
  • HBV Seroconversion Panel Donor# 68541 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 68739 (14 X 1 mL)

HBV11017 14 X 1 mL
EUR 859.12
  • What is the product classification?
  • HBV Seroconversion Panel Donor# 68739 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 70793 (14 X 1 mL)

HBV11024 14 X 1 mL
EUR 859.12
  • What is the product classification?
  • HBV Seroconversion Panel Donor# 70793 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 70970 (16 X 1 mL)

HBV11026 16 X 1 mL
EUR 859.12
  • What is the product classification?
  • HBV Seroconversion Panel Donor# 70970 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 71415 (13 X 1 mL)

HBV11027 13 X 1 mL
EUR 859.12
  • What is the product classification?
  • HBV Seroconversion Panel Donor# 71415 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 71840 (10 X 1 mL)

HBV11028 10 X 1 mL
EUR 859.12
  • What is the product classification?
  • HBV Seroconversion Panel Donor# 71840 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 69751 (13 X 1 mL)

HBV11029 13 X 1 mL
EUR 859.12
  • What is the product classification?
  • HBV Seroconversion Panel Donor# 69751 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 70292 (15 X 1 mL)

HBV11031 15 X 1 mL
EUR 859.12
  • What is the product classification?
  • HBV Seroconversion Panel Donor# 70292 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 72439 (13 X 1 mL)

HBV11052 13 X 1 mL
EUR 859.12
  • What is the product classification?
  • HBV Seroconversion Panel Donor# 72439 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 72474 (11 X 1 mL)

HBV11056 11 X 1 mL
EUR 859.12
  • What is the product classification?
  • HBV Seroconversion Panel Donor# 72474 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 71612 (8 X 1 mL)

HBV11058 8 X 1 mL
EUR 859.12
  • What is the product classification?
  • HBV Seroconversion Panel Donor# 71612 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 72324 (9 X 1 mL)

HBV11059 9 X 1 mL
EUR 859.12
  • What is the product classification?
  • HBV Seroconversion Panel Donor# 72324 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 71922 (11 X 1 mL)

HBV11062 11 X 1 mL
EUR 859.12
  • What is the product classification?
  • HBV Seroconversion Panel Donor# 71922 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 71782 (9 X 1 mL)

HBV11064 9 X 1 mL
EUR 859.12
  • What is the product classification?
  • HBV Seroconversion Panel Donor# 71782 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 73299 (15 X 1 mL)

HBV11069 15 X 1 mL
EUR 859.12
  • What is the product classification?
  • HBV Seroconversion Panel Donor# 73299 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 61248 (5 X 1 mL)

HBV6271 5 X 1 mL
EUR 859.12
  • What is the product classification?
  • HBV Seroconversion Panel Donor# 61248 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 61291 (25 X 1 mL)

HBV6272 25 X 1 mL
EUR 859.12
  • What is the product classification?
  • HBV Seroconversion Panel Donor# 61291 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 61042 (6 X 1 mL)

HBV6273 6 X 1 mL
EUR 859.12
  • What is the product classification?
  • HBV Seroconversion Panel Donor# 61042 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 61799 (7 X 1 mL)

HBV6274 7 X 1 mL
EUR 859.12
  • What is the product classification?
  • HBV Seroconversion Panel Donor# 61799 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 61066 (7 X 1 mL)

HBV6275 7 X 1 mL
EUR 859.12
  • What is the product classification?
  • HBV Seroconversion Panel Donor# 61066 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 60409 (8 X 1 mL)

HBV6276 8 X 1 mL
EUR 859.12
  • What is the product classification?
  • HBV Seroconversion Panel Donor# 60409 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 63291 (11 X 1 mL)

HBV6277 11 X 1 mL
EUR 859.12
  • What is the product classification?
  • HBV Seroconversion Panel Donor# 63291 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 63426 (10 X 1 mL)

HBV6278 10 X 1 mL
EUR 859.12
  • What is the product classification?
  • HBV Seroconversion Panel Donor# 63426 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 63701 (7 X 1 mL)

HBV6279 7 X 1 mL
EUR 859.12
  • What is the product classification?
  • HBV Seroconversion Panel Donor# 63701 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 61832 (5 X 1 mL)

HBV6280 5 X 1 mL
EUR 859.12
  • What is the product classification?
  • HBV Seroconversion Panel Donor# 61832 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 62433 (12 X 1 mL)

HBV6281 12 X 1 mL
EUR 1695.28
  • What is the product classification?
  • HBV Seroconversion Panel Donor# 62433 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 62675 (14 X 1 mL)

HBV6282 14 X 1 mL
EUR 859.12
  • What is the product classification?
  • HBV Seroconversion Panel Donor# 62675 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 62825 (11 X 1 mL)

HBV6283 11 X 1 mL
EUR 859.12
  • What is the product classification?
  • HBV Seroconversion Panel Donor# 62825 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 62347 (19 X 1 mL)

HBV6284 19 X 1 mL
EUR 859.12
  • What is the product classification?
  • HBV Seroconversion Panel Donor# 62347 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 62967 (16 X 1 mL)

HBV6285 16 X 1 mL
EUR 859.12
  • What is the product classification?
  • HBV Seroconversion Panel Donor# 62967 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 63133 (9 X 1 mL)

HBV6286 9 X 1 mL
EUR 859.12
  • What is the product classification?
  • HBV Seroconversion Panel Donor# 63133 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 63253 (11 X 1 mL)

HBV6287 11 X 1 mL
EUR 859.12
  • What is the product classification?
  • HBV Seroconversion Panel Donor# 63253 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 63568 (9 X 1 mL)

HBV6288 9 X 1 mL
EUR 859.12
  • What is the product classification?
  • HBV Seroconversion Panel Donor# 63568 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 63659 (10 X 1 mL)

HBV6289 10 X 1 mL
EUR 859.12
  • What is the product classification?
  • HBV Seroconversion Panel Donor# 63659 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 63997 (12 X 1 mL)

HBV6290 12 X 1 mL
EUR 859.12
  • What is the product classification?
  • HBV Seroconversion Panel Donor# 63997 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 64121 (8 X 1 mL)

HBV6291 8 X 1 mL
EUR 859.12
  • What is the product classification?
  • HBV Seroconversion Panel Donor# 64121 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 64006 (12 X 1 mL)

HBV6292 12 X 1 mL
EUR 859.12
  • What is the product classification?
  • HBV Seroconversion Panel Donor# 64006 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 64132 (7 X 1 mL)

HBV6293 7 X 1 mL
EUR 859.12
  • What is the product classification?
  • HBV Seroconversion Panel Donor# 64132 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 66481 (17 X 1 mL)

HBV9072 17 X 1 mL
EUR 859.12
  • What is the product classification?
  • HBV Seroconversion Panel Donor# 66481 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 65099 (16 X 1 mL)

HBV9073 16 X 1 mL
EUR 859.12
  • What is the product classification?
  • HBV Seroconversion Panel Donor# 65099 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 66213 (20 X 1 mL)

HBV9074 20 X 1 mL
EUR 859.12
  • What is the product classification?
  • HBV Seroconversion Panel Donor# 66213 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 1034644 (37 X 1 mL)

HBV9092 37 X 1 mL
EUR 2344.24
  • What is the product classification?
  • HBV Seroconversion Panel Donor# 1034644 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 1087380 (31 X 1 mL)

HBV9093 31 X 1 mL
EUR 2344.24
  • What is the product classification?
  • HBV Seroconversion Panel Donor# 1087380 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 74302 (17 X 1 mL)

HBV9098 17 X 1 mL
EUR 1129.52
  • What is the product classification?
  • HBV Seroconversion Panel Donor# 74302 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

HBV Seroconversion Panel Donor# 75255 (20 X 1 mL)

HBV9099 20 X 1 mL
EUR 1129.52
  • What is the product classification?
  • HBV Seroconversion Panel Donor# 75255 is marked as RUO.
Description: Please contact Gentaur in order to receive the datasheet of the product.

Ivd/ Rat Ivd ELISA Kit

ELI-39421r 96 Tests
EUR 886

IVD antibody

22140-100ul 100ul
EUR 390

IVD antibody

70R-18039 50 ul
EUR 435
Description: Rabbit polyclonal IVD antibody

IVD antibody

70R-13603 100 ul
EUR 457
Description: Affinity purified Rabbit polyclonal IVD antibody

IVD antibody

10R-4491 100 ul
EUR 691
Description: Mouse monoclonal IVD antibody

IVD Antibody

DF12284 200ul
EUR 304
Description: IVD antibody detects endogenous levels of IVD.

IVD Antibody

1-CSB-PA011921GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against IVD. Recognizes IVD from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC

IVD Antibody

1-CSB-PA011921LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against IVD. Recognizes IVD from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:500-1:1000

IVD siRNA

20-abx902738
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

IVD siRNA

20-abx920988
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

IVD siRNA

20-abx920989
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-IVD

YF-PA12811 50 ug
EUR 363
Description: Mouse polyclonal to IVD

anti-IVD

YF-PA12812 100 ug
EUR 403
Description: Rabbit polyclonal to IVD

IVD Polyclonal Antibody

28898-100ul 100ul
EUR 252

IVD Polyclonal Antibody

28898-50ul 50ul
EUR 187

IVD Rabbit pAb

A15281-100ul 100 ul
EUR 308

IVD Rabbit pAb

A15281-200ul 200 ul
EUR 459

IVD Rabbit pAb

A15281-20ul 20 ul
EUR 183

IVD Rabbit pAb

A15281-50ul 50 ul
EUR 223

Human IVD Antibody

33170-05111 150 ug
EUR 261

IVD Blocking Peptide

DF12284-BP 1mg
EUR 195