Evolution and genetics of bighead and silver carps: Native population conservation versus invasive species control

Bighead carp (Hypophthalmichthys nobilis) and silver carp (H. molitrix), collectively referred to as bigheaded carps, are cyprinids native primarily to China and have been launched to over 70 nations. Paleontological and molecular phylogenetic analyses exhibit bighead and silver carps originated from the Yangtze-Huanghe River basins and trendy populations could have derived from the secondary contact of geographically remoted fish over the past glacial occasions. Important genetic variations are discovered amongst populations of native rivers (Yangtze, Pearl, and Amur) in addition to launched/invasive environments (Mississippi R., USA and Danube R., Hungary), suggesting genetic backgrounds and ecological choice could play a job in inhabitants differentiation.


Inhabitants divergence of bighead carp or silver carp has occurred inside their native rivers, whereas, throughout the Mississippi River Basin (MRB)-an launched area, such genetic differentiation is probably going going down at the least in silver carp. Interspecific hybridization between silver and bighead carps is uncommon inside their native areas; nevertheless, intensive hybridization is noticed within the MRB, which could possibly be contributed by a shift to a extra homogenous setting that lacks reproductive isolation limitations for the restriction of gene move between species.

The wild populations of native bighead and silver carps have skilled dramatic declines; in distinction, the launched bigheaded carps overpopulate the MRB and are thought-about two invasive species, which strongly suggests fishing capability (overfishing and underfishing) be a decisive issue for fishery useful resource exploitation and administration. This assessment offers not solely a world perspective of evolutionary historical past and inhabitants divergence of bigheaded carps but additionally a discussion board that requires worldwide analysis collaborations to take care of essential points associated to native inhabitants conservation and invasive species management.

A brand new genus of pliopithecoid from the late Early Miocene of China and its implications for understanding the paleozoogeography of the Pliopithecoidea

A variety of pliopithecoids is thought from Miocene localities in Europe, however till just lately, this group was comparatively poorly represented in China. Nonetheless, new discoveries have proven that Chinese language pliopithecoids have been taxonomically various and geographically widespread. The earliest pliopithecoids in China (and Eurasia) are Dionysopithecus and Platodontopithecus from the Early Miocene of Sihong, Jiangsu (∼19-18 Ma). Throughout the Center Miocene (∼15-12 Ma), a number of species of pliopithecoids are recorded at localities in Gansu Province (Laogou), Internal Mongolia (Damiao), Xinjiang Uygur Autonomous Area (Tieersihabahe), and Ningxia Hui Autonomous Area (Tongxin).
Lastly, a late-surviving anapithecine crouzeliid, Laccopithecus robustus, is thought from the Late Miocene (∼7 Ma) of Shihuiba in Yunnan, which postdates the extinction of pliopithecoids in Europe (throughout MN 10). Paleontological investigations at a late Early Miocene locality close to Fanchang in Anhui Province have yielded a big pattern of remoted enamel (a couple of hundred) of a beforehand unknown species of pliopithecoid. The related micromammals point out an age contemporaneous with the Shanwang Formation in Shandong Province (MN 3-4, ∼18-17 Ma). All the everlasting enamel are represented aside from I2.
With its distinctive suite of dental options, the Fanchang pliopithecoid might be attributed to a brand new species and genus. Shared derived options of the decrease molars affirm that the Fanchang pliopithecoid has its closest affinities with European crouzeliids, however quite a few primitive traits point out that it’s a stem member of the clade. The proof factors to China as an vital heart for the early diversification of pliopithecoids. Opposite to earlier zoogeographic eventualities, the prevalence of an early crouzeliid in China implies that the Pliopithecidae and Crouzeliidae could have diverged from a stem pliopithecoid in Asia in the course of the Early Miocene earlier than their arrival in Europe.
 Evolution and genetics of bighead and silver carps: Native population conservation versus invasive species control
Evolution and genetics of bighead and silver carps: Native population conservation versus invasive species control

Radiographic evaluation and digital cleansing of a bioarchaeological stay enclosed in mineral deposits from a limestone cave

In limestone caves, environmental processes usually trigger alterations of human or animal skeletal stays, complicating classical analytical strategies. Exemplary, a proximal femoral skeletal fragment, enclosed by a thick layer of speleothemic calcite deposits, was found in the course of the exploration of the Bedara collapse Žumberak, Croatia. An examination with out elimination of the encompassing mineral deposits, presumably main to break of the specimen, was, subsequently, fascinating.We describe and talk about the utilized methods, together with medical computed tomography, digital cleansing by a specifically developed segmentation protocol utilizing an open-source DICOM viewer, and digital visualisation and dimensioning utilizing computer-aided design software program, in order that this “hidden” specimen could possibly be non-invasively examined in nice element.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

A1cf/ Rat A1cf ELISA Kit

ELI-24686r 96 Tests
EUR 886

A1CF Antibody

39439-100ul 100ul
EUR 390

A1CF antibody

70R-4765 50 ug
EUR 467
Description: Rabbit polyclonal A1CF antibody raised against the N terminal of A1CF

A1CF antibody

70R-4770 50 ug
EUR 467
Description: Rabbit polyclonal A1CF antibody raised against the N terminal of A1CF


YF-PA18666 50 ul
EUR 363
Description: Mouse polyclonal to A1CF


YF-PA18667 50 ug
EUR 363
Description: Mouse polyclonal to A1CF

A1CF Polyclonal Antibody

27891-100ul 100ul
EUR 252

A1CF Polyclonal Antibody

27891-50ul 50ul
EUR 187

A1CF Rabbit pAb

A13087-100ul 100 ul
EUR 308

A1CF Rabbit pAb

A13087-200ul 200 ul
EUR 459

A1CF Rabbit pAb

A13087-20ul 20 ul
EUR 183

A1CF Rabbit pAb

A13087-50ul 50 ul
EUR 223

A1CF Blocking Peptide

33R-2286 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of A1CF antibody, catalog no. 70R-4765

A1CF Blocking Peptide

33R-5962 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of A1CF antibody, catalog no. 70R-4770

A1CF cloning plasmid

CSB-CL001002HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 369
  • Sequence: atggaatcaaatcacaaatccggggatggattgagcggcactcagaaggaagcagccctccgcgcactggtccagcgcacaggatatagcttggtccaggaaaatggacaaagaaaatatggtggccctccacctggttgggatgctgcaccccctgaaaggggctgtgaaatttt
  • Show more
Description: A cloning plasmid for the A1CF gene.

A1CF cloning plasmid

CSB-CL001002HU2-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1785
  • Sequence: atggaatcaaatcacaaatccggggatggattgagcggcactcagaaggaagcagccctccgcgcactggtccagcgcacaggatatagcttggtccaggaaaatggacaaagaaaatatggtggccctccacctggttgggatgctgcaccccctgaaaggggctgtgaaattt
  • Show more
Description: A cloning plasmid for the A1CF gene.

Anti-A1CF antibody

STJ115054 100 µl
EUR 277
Description: Mammalian apolipoprotein B mRNA undergoes site-specific C to U deamination, which is mediated by a multi-component enzyme complex containing a minimal core composed of APOBEC-1 and a complementation factor encoded by this gene. The gene product has three non-identical RNA recognition motifs and belongs to the hnRNP R family of RNA-binding proteins. It has been proposed that this complementation factor functions as an RNA-binding subunit and docks APOBEC-1 to deaminate the upstream cytidine. Studies suggest that the protein may also be involved in other RNA editing or RNA processing events. Several transcript variants encoding a few different isoforms have been found for this gene.


EF004624 96 Tests
EUR 689

Rat A1CF shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Mouse A1CF shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

A1CF Polyclonal Conjugated Antibody

C27891 100ul
EUR 397

Human A1CF shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

A1CF Recombinant Protein (Human)

RP000004 100 ug Ask for price

A1CF Recombinant Protein (Human)

RP036346 100 ug Ask for price

A1CF Recombinant Protein (Mouse)

RP112937 100 ug Ask for price

A1CF Recombinant Protein (Rat)

RP188426 100 ug Ask for price

APOBEC1 Complementation Factor (A1CF) Antibody

abx038090-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

A1cf ORF Vector (Rat) (pORF)

ORF062810 1.0 ug DNA
EUR 506

A1CF ORF Vector (Human) (pORF)

ORF000002 1.0 ug DNA
EUR 95

A1CF ORF Vector (Human) (pORF)

ORF012116 1.0 ug DNA
EUR 354

A1cf ORF Vector (Mouse) (pORF)

ORF037647 1.0 ug DNA
EUR 506

A1CF ELISA Kit (Mouse) (OKEI00351)

OKEI00351 96 Wells
EUR 663
Description: Description of target: Essential component of the apolipoprotein B mRNA editing enzyme complex which is responsible for the postranscriptional editing of a CAA codon for Gln to a UAA codon for stop in APOB mRNA. Binds to APOB mRNA and is probably responsible for docking the catalytic subunit, APOBEC1, to the mRNA to allow it to deaminate its target cytosine. The complex also seems to protect the edited APOB mRNA from nonsense-mediated decay.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 18.75 pg/mL

A1cf sgRNA CRISPR Lentivector set (Rat)

K6946101 3 x 1.0 ug
EUR 339

A1CF sgRNA CRISPR Lentivector set (Human)

K0013501 3 x 1.0 ug
EUR 339

A1cf sgRNA CRISPR Lentivector set (Mouse)

K3848601 3 x 1.0 ug
EUR 339

Human APOBEC1 complementation factor, A1CF ELISA KIT

ELI-12253h 96 Tests
EUR 824

Human APOBEC1 Complementation Factor (A1CF) ELISA Kit

abx384593-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse APOBEC1 Complementation Factor (A1CF) ELISA Kit

abx388595-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Rat APOBEC1 Complementation Factor (A1CF) ELISA Kit

abx390981-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse APOBEC1 complementation factor, A1cf ELISA KIT

ELI-35057m 96 Tests
EUR 865

A1cf sgRNA CRISPR Lentivector (Rat) (Target 1)

K6946102 1.0 ug DNA
EUR 154

A1cf sgRNA CRISPR Lentivector (Rat) (Target 2)

K6946103 1.0 ug DNA
EUR 154

A1cf sgRNA CRISPR Lentivector (Rat) (Target 3)

K6946104 1.0 ug DNA
EUR 154

A1CF sgRNA CRISPR Lentivector (Human) (Target 1)

K0013502 1.0 ug DNA
EUR 154

A1CF sgRNA CRISPR Lentivector (Human) (Target 2)

K0013503 1.0 ug DNA
EUR 154

A1CF sgRNA CRISPR Lentivector (Human) (Target 3)

K0013504 1.0 ug DNA
EUR 154

A1cf sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3848602 1.0 ug DNA
EUR 154

A1cf sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3848603 1.0 ug DNA
EUR 154

A1cf sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3848604 1.0 ug DNA
EUR 154

A1CF Protein Vector (Human) (pPB-C-His)

PV000005 500 ng
EUR 329

A1CF Protein Vector (Human) (pPB-N-His)

PV000006 500 ng
EUR 329

A1CF Protein Vector (Human) (pPM-C-HA)

PV000007 500 ng
EUR 329

A1CF Protein Vector (Human) (pPM-C-His)

PV000008 500 ng
EUR 329

A1CF Protein Vector (Mouse) (pPB-C-His)

PV150586 500 ng
EUR 603

A1CF Protein Vector (Mouse) (pPB-N-His)

PV150587 500 ng
EUR 603

A1CF Protein Vector (Mouse) (pPM-C-HA)

PV150588 500 ng
EUR 603

A1CF Protein Vector (Mouse) (pPM-C-His)

PV150589 500 ng
EUR 603

A1CF Protein Vector (Rat) (pPB-C-His)

PV251238 500 ng
EUR 603

A1CF Protein Vector (Rat) (pPB-N-His)

PV251239 500 ng
EUR 603

A1CF Protein Vector (Rat) (pPM-C-HA)

PV251240 500 ng
EUR 603

A1CF Protein Vector (Rat) (pPM-C-His)

PV251241 500 ng
EUR 603

A1CF Protein Vector (Human) (pPB-His-MBP)

PV318482 500 ng
EUR 329

A1CF Protein Vector (Human) (pPB-His-GST)

PV318483 500 ng
EUR 329

A1CF Protein Vector (Human) (pPB-His-MBP)

PV318486 500 ng
EUR 481

A1CF Protein Vector (Human) (pPB-His-GST)

PV318487 500 ng
EUR 481

A1CF Protein Vector (Human) (pPB-C-His)

PV048461 500 ng
EUR 481

A1CF Protein Vector (Human) (pPB-N-His)

PV048462 500 ng
EUR 481

A1CF Protein Vector (Human) (pPM-C-HA)

PV048463 500 ng
EUR 481

A1CF Protein Vector (Human) (pPM-C-His)

PV048464 500 ng
EUR 481

A1cf 3'UTR Luciferase Stable Cell Line

TU101042 1.0 ml Ask for price

A1cf 3'UTR GFP Stable Cell Line

TU151042 1.0 ml Ask for price

A1cf 3'UTR Luciferase Stable Cell Line

TU200002 1.0 ml Ask for price

A1cf 3'UTR GFP Stable Cell Line

TU250002 1.0 ml Ask for price

A1CF 3'UTR GFP Stable Cell Line

TU050003 1.0 ml
EUR 1394

A1CF 3'UTR Luciferase Stable Cell Line

TU000003 1.0 ml
EUR 1394

A1CF Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV702531 1.0 ug DNA
EUR 450

A1CF Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV702535 1.0 ug DNA
EUR 450

A1CF Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV702536 1.0 ug DNA
EUR 450

A1CF Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV671083 1.0 ug DNA
EUR 682

A1CF Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV671087 1.0 ug DNA
EUR 682

A1CF Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV671088 1.0 ug DNA
EUR 682

A1cf ELISA Kit| Rat APOBEC1 complementation factor ELISA Kit

EF018334 96 Tests
EUR 689

A1cf ELISA Kit| Mouse APOBEC1 complementation factor ELISA Kit

EF014220 96 Tests
EUR 689

A1CF Protein Vector (Human) (pPM-N-D-C-HA)

PV318484 500 ng
EUR 552

A1CF Protein Vector (Human) (pPM-N-D-C-His)

PV318485 500 ng
EUR 552

A1CF Protein Vector (Human) (pPM-N-D-C-HA)

PV318488 500 ng
EUR 552

A1CF Protein Vector (Human) (pPM-N-D-C-His)

PV318489 500 ng
EUR 552

A1cf sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K6946105 3 x 1.0 ug
EUR 376

A1CF sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K0013505 3 x 1.0 ug
EUR 376

A1cf sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K3848605 3 x 1.0 ug
EUR 376

A1CF Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-C-term-HA)

LV702532 1.0 ug DNA
EUR 450

A1CF Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)

LV702533 1.0 ug DNA
EUR 508

A1CF Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)

LV702534 1.0 ug DNA
EUR 508

A1CF Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA)

LV671084 1.0 ug DNA
EUR 682

A1CF Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)

LV671085 1.0 ug DNA
EUR 740

A1CF Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)

LV671086 1.0 ug DNA
EUR 740

A1cf sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)

K6946106 1.0 ug DNA
EUR 167

A1cf sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)

K6946107 1.0 ug DNA
EUR 167

A1cf sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)

K6946108 1.0 ug DNA
EUR 167

A1CF sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K0013506 1.0 ug DNA
EUR 167

A1CF sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K0013507 1.0 ug DNA
EUR 167

A1CF sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K0013508 1.0 ug DNA
EUR 167

A1cf sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)

K3848606 1.0 ug DNA
EUR 167

A1cf sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)

K3848607 1.0 ug DNA
EUR 167

A1cf sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)

K3848608 1.0 ug DNA
EUR 167


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Calcitonin siRNA

  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ZNF365 siRNA

  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Calcitonin siRNA

  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ZNF365 siRNA

  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.
We additionally report on the circumstances and origin of the discover, the outcomes of radiocarbon courting, and its anatomical and taxonomic identification, in response to which, the bone fragment belonged to a wild boar (Sus scrofa) from the timeframe of the Center Eneolithic Retz-Gajary tradition within the area (4,781 ± 35 years earlier than current). This research offers a reference for future paleontological and anthropological analyses, searching for to unlock the big potential of anatomical research of comparable skeletal stays which might be both petrified or enclosed in speleothemic deposits.

Leave a Reply

Your email address will not be published. Required fields are marked *